Biotechnology Question Set 1

1.A continuous reactor is converting maltose to lactate, acetate and ethanol. The medium contains 40 g.l^-1 of maltose and the medium flow rate is 5 liters per hour and the effluent contains 20 g.l^-1 of lactate. What is the productivity of lactate production from this reactor?

   

1. 10 Liters Per Hour

   

2. 20 G Lactate/L

   

3. 100 G Lactate/H

   

4. 4 G Lactate/H

 

2.Transplastomics…..

   

1. Offers Little Opportunity For Practical Use

   

2. Produces Genes That Are Released In Pollen

   

3. Provides Exceptionally Low Yields Of Protein Products

   

4. Targets Genes In The Chloroplast

3.K_M values of enzyme X for substrate A and B are 0.1mM and 0.01mM respectively. This suggest that

P) Enzyme X has more affinity towards A

Q) Enzyme X has low affinity towards A

R) Enzyme X has more affinity towards B

S) Enzyme X has low affinity towards B

     1. Q, R

   

2. Q, S

   

3. R, S

   

4. P, Q

4.The specific growth rate (µ) of a microorganism in stationary phase is

   

1. 0 (Zero)

   

2. µ max

   

3. less than zero

   

4. greater than zero

5.Co-factor for Glutathione peroxidase is

   

1. Mo

   

2. Se

   

3. Mg

   

4. Fe

6.Match each parameter in group 1 with the appropriate measuring device in group 2

Group 1                     Group 2

P. Pressure                  1. Photometer

Q. Impeller speed       2. Rotameter

R. Turbidity                3. Diaphragm gauge

S. Flow rate                4. Tachometer

   

1. P-3, Q-4, R-1, S-2

   

2. P-1, Q-3, R-2, S-4

   

3. P-4, Q-1, R-2, S-3

   

4. P-1, Q-2, R-3, S-4

7.A fed-batch reactor initially contained 2 litre of medium and 1 g.l^-1 of substrate. It was fed at 1 litre per hour with a medium containing 1 g.l^-1 of substrate. After 10 hours, the concentration of substrate in the reactor was 0.5 g.l^-1. The mass of substrate that was used by the culture in the reactor was

   

1. 1 G

   

2. 3 G

   

3. 6 G

   

4. 12 G

8.A knock-out mouse is made using which of the following methods/technologies?

   

1. Monoclonal Antibody

   

2. Antisense Oligonucleotide

   

3. Transgenic

   

4. Animal Cloning

 

9.The phenomenon in which substrates are used in a sequential manner is known as

   

1. Dialysis

   

2. Multiplicity

   

3. Diauxie

   

4. Dialism

10.How many kilograms of ethanol is produced from 1 kilogram of glucose in ethanol fermentation?

   

1. 2.00

   

2. 0.20

   

3. 0.51

   

4. 0.05

 

11.Molecular clock of evolution could be traced on basis of

   

1. Comparison Of Short Arm Of 16-S RNA

   

2. Substitution In Amino Acids Of Polypeptide Due To Mutation

   

3. DNA Fingerprinting

   

4. Fossil Study 

12.Alkaline phosphatase is used

   

1. To Remove A Phosphate At The 5`End Of DNA

   

2. To Remove A Phosphate At The 3`End Of DNA

   

3. To Add A Phosphate At The 5`End Of DNA

   

4. To Add A Phosphate At The 3`End Of DNA

 

13.The following antibiotics affect the bacterial protein synthesis with their site of action. Which of the following combinations is correct?

Antibiotic                                Site of action
P. Streptomycin                     1. aminoacyl tRNA association with ribosome
Q. Tetracycline                      2. Transpeptidation
R. erythromycin                    3. Translocation
S. Chloramphenicol              4. Initiation of protein synthesis

   

1. P-2; Q-3; R-4; S-1

   

2. P-4; Q-1; R-3; S-2

   

3. P-1; Q-4; R-3; S-2

   

4. P-4; Q-1; R-2; S-3

14.A fermentation system has a k_La of 3 s^-1 and a C_o^* of 5 ppm of O₂. If the bulk liquid is completely depleted of oxygen, then the oxygen transfer rate will equal to

   

1. 5 Mg/L/S

   

2. 10mg/L/S

   

3. 15 Mg/L/S

   

4. Zero

 

15.In a Lineweaver-Burk treatment of data, which of the following plots would give you a straight line of gradient Km/Vmax?

   

1. 1/V Against [S]

   

2. 1/V Against 1/[S]

   

3. V Against 1/[S]

   

4. V Against [S]

16.A chemostat has a liquid volume of 2 litres and is being fed at a rate of 4 litres per hour. The dilution rate for this reactor would be

   

1. 2 Per Hour

   

2. 4 Litres Per Hour

   

3. 2 Litres

   

4. 8 Litres Per Square Hour

17.An E. coli strain that requires the amino acid lysine for growth is termed a/an

   

1. Autotroph

   

2. Auxotroph

   

3. Lysotroph

   

4. Prototroph

18.Pseudomonas aeruginosa has a maximum specific growth rate of 0.8 h^-1 when grown on glucose as a growth limiting substrate. To ensure that the cells do not washout, the dilution rate must be set to

   

1. Equal To 0.8 /H

   

2. Greater Than 0.8 /H

   

3. Less Than 0.8 /H

   

4. Less Than Half The Inverse Of The Residence Time

19.A strain of Azotobacter is cultured in a 15 m³ stirred bioreactor for alginate production. Under operating conditions k_La is 0.17 s^-1. Oxygen solubility in the broth is 8×10^-3kg m^-3. The specific rate of oxygen uptake is 12.5mmol g^-1h^-1. The Maximum possible cell concentration is

   

1. 10 G /L

   

2. 12 G /L

   

3. 14 G /L

   

4. 8 G /L

20.Shine-Dalgarno sequences are associated with

   

1. Transcription

   

2. Translation

   

3. Replication

   

4. Recombination

21. Which of the following would not be expected to result in a dysfunctional protein?
      a.Mutation affecting the splice site of an intron
      b.Substitution of glycine for alanine at the carboxyl terminus
      c.Insertion of two bases in the code for the amino end
      d.Nonsense mutation affecting the middle of a potential protein product
      e.Deletion of a single base of a codon near the middle of a potential protein
 
22. Which of the following is a true statement about translation?
      a.The genetic code can be overlapping
      b.The first nucleotide in a codon has less specificity than the others
      c.Only one group of nucleotides codes for each single amino acid
      d.Every codon (three nucleotide bases) specifies an amino acid
      e.Specific nucleotide sequences signal termination of peptide chains
 
23. A patient suffers from adenosine deaminase (ADA) deficiency, an autosomal recessive immune deficiency in which bone marrow lymphoblasts cannot replicate to generate immunocompetent lymphocytes. The treatment option that would permanently cure the patient is
      a.Germ-line gene therapy to replace one ADA gene copy
      b.Germ-line gene therapy to replace both ADA gene copies
      c.Somatic cell gene therapy to replace one ADA gene copy in circulating lymphocytes
      d.Somatic cell gene therapy to replace both ADA gene copies in circulating lymphocytes
      e.Somatic cell gene therapy to replace one ADA gene copy in bone marrow lymphoblasts
 
24. The proopiomelanocortin (POMC) gene encodes several regulatory proteins that affect pituitary function. In different brain regions, proteins encoded by this gene have different carboxy-terminal peptides. Which of the following best explains the regulatory mechanism?
     a.POMC transcription is regulated by different factors in different brain regions
     b.POMC translation elongation is regulated by different factors in different brain regions
     c.POMC transcription has different enhancers in different brain regions
     d.POMC protein undergoes different protein processing in different brain regions
     e.POMC protein forms different allosteric complexes in different brain regions

25. A family in which several individuals have arthritis and detached retina is diagnosed with Stickler syndrome. The locus for Stickler syndrome has been mapped near that for type II collagen on chromosome 12, and mutations in the COL2A1 gene have been described in Stickler syndrome. The family became interested in molecular diagnosis to distinguish normal from mildly affected individuals. Which of the results below would be expected in an individual with a promoter mutation at one COL2A1 gene locus?
     a.Western blotting detects no type II collagen chains
     b.Southern blotting using intronic restriction sites yields normal restriction fragment sizes
     c.Reverse transcriptaseñpolymerase chain reaction (RT-PCR) detects one-half normal amounts of COL2A1 mRNA in affected individuals
     d.Fluorescent in situ hybridization (FISH) analysis using a COL2A1 probe detects signals on only one chromosome 12
    

e.DNA sequencing reveals a single nucleotide difference between homologous COL2A1 exons
Answer key:

1-b
2-e
3-e
4-d
5-c

Question On 3rd Sep.CMB 613

DNA to PROTEIN

From DNA to Protein

Multiple Choice

1.  During the process of translation:

         A. the peptide is ‘passed’ from the tRNA in the P-site to the tRNA in the A-site.

         B. incoming tRNAs must first bind to the E-site.

         C. initiation begins with the binding of the ribosomal SSU to the poly-A tail of the mRNA.

         D. the mRNA is translated by one ribosome at a time.

2. The presence of a poly-A tail on a RNA molecule indicates that:

         A. there are exons present that must be removed.

         B. this RNA molecule does not contain introns.

         C. the transcript should be immediately degraded.

         D. this is a rRNA molecule.

         E. None of the above answers is correct

3.  A ‘proteasome’ is a large structure in the cytoplasm that:

         A. translates mRNA into protein           C. supercoils DNA

         B. processes RNA                                  D. enzymatically degrades proteins

4. During the processing of introns, a single snRNP complex catalyzes both the cleavage of the RNA and the joining of the cut ends.  What would be the consequence if these two processes were catalyzed by separate enzymes not associated in a single complex?

         A. the rate of RNA processing would be much faster.

         B. the cell would be unable to identify the correct cleavage sites.

         C. the exons might not be joined in the correct sequence.

         D. exons instead of introns would be cleaved from the RNA molecule.

5. The nucleolus of the nucleus is the site where:

         A. RNA processing occurs

         B. rRNA is transcribed and ribosomal subunits are assembled

         C. tRNA are charged with amino acids

         D. mRNA is translated into protein

6. During "RNA processing"

         A. all of the exons are removed and discarded

         B. the RNA molecule is made from a DNA template.

         C. introns are cut from the RNA and the exons are spliced together.

         D. the RNA molecule is translated into a protein molecule.

7. How does the cell ‘mark’ the positions of introns in an immature RNA?

         A. There is a special snRNP for each type of intron.

         B. Codons called ‘cut’ and ‘paste’ (copyrighted by Microsoft) are present within the RNA.

         C.  It doesn’t need to, since the boundary between an intron and exon alternates frequently.

         D. Special sequences are located near the splicing sites which are recognized by ribozymes.

                                                                                                           

8. “Alternative splicing” refers to:

         A. the use of introns as exons, or vice versa, during RNA processing

         B. splicing out of damaged DNA by DNA repair enzymes.

         C. joining of RNA from two different genes to form a new mRNA.

         D. the use of alternative reading frames when translating an mRNA.

         E. a new dance for people with alternative life styles.

9.  During transcription of DNA to RNA:

         A. an RNA polymerase moves along the DNA in the 5’ to the 3’ direction .

         B. the 3’ end of the RNA molecule is produced first.

         C. an RNA polymerase must first bind to a promoter sequence.

         D. transcription is always initiated at a “start codon.”

10.  During the ‘elongation’ stage of translation, after the arrival of each new tRNA:

         A. the amino acid is ‘passed’ from the tRNA in the A-site to the tRNA in the P-site.

         B. newly arriving tRNAs must first bind to the E-site.

         C. the peptide is ‘passed’ from the tRNA in the P-site to the tRNA in the A-site.

         D. the new tRNA must first bind to the P-site of the ribozome.

11. During transcription of a particular gene, the RNA polymerase will transcribe:

         A. both strands, but only one of RNA molecule will be used.

         B. only one of the DNA strands, moving in a 3’ to 5’ direction along the template.

         C. both strands, but moving 3’ to 5’ for one and 5’ to 3’ along the other.

         D. only the exons of the gene while skipping over the introns.

12. Since the two strands of the DNA molecule are complementary, for any given gene:

         A. The RNA polymerase can bind to either strand.

         B. Only one strand actually carries the genetic code for a particular gene.

         C. Each gene possesses an exact replica that can be used should a mutation occur.

         D. A gene transcribed in the 5’ to 3’ direction on one strand can be transcribed  in the 3’ to 5’ direction on the other strand.

13. In the genetic code there are:

         A. more tRNAs than codons.                C. more nucleotides than codons.

         B. more codons than amino acids.         D. the same number of codons and amino acids

14. Initiation of translation begins when the:

         A. large and small subunits link together, then bind to the mRNA.

         B. ribosomal small subunit holding an initiator tRNA binds to the 5’ end of the mRNA.

         C. ribosome binds to the start codon and an initiator tRNA enters the ribosome.

         D. initiator tRNA binds to the start codon, followed by binding of the ribosome large subunit.

15. A “TATA box” is

A. the translation termination sequence.

B. an important base sequence in the promoters of bacteria.

C. the site where the RNA polymerase II binding complex is assembled.

D. an example of one of the translation stop codons.

16. According to the RNA-world theory:

            A. RNA molecules were the first organic molecules formed on earth.

            B. Life evolved on another planet called the “RNA World.”

            C. All RNA molecules in cells are “ribozymes.”

            D. Primitive RNA molecules evolved before protein and DNA

17. It seems probable that DNA contains thymine instead of uracil because:

            A. thymine is chemically much more stable than uracil.

            B. when uracil is chemically deaminated, thymine is produced.

            C. thymine was one of the first four nucleotides in primitive RNA molecules.

            D. if cytosine is deaminated, the altered base can be detected and removed.

True or False

1. Each of the 3 potential reading frames of an mRNA can produce a functional, but different, protein.

2. Transcription is terminated when the RNA polymerase encounters a poly-U sequence.

3. Translation ends when a ‘release factor’ protein binds to a stop codon.

4. Initiation of translation in prokaryotes involves binding of the sigma factor to a promoter.

5. Only rRNAs are polyadenylated.

6. Because genes can be coded on either strand of the DNA double helix, the coding regions of different genes can overlap.

7. Some antibiotics have selective effects upon prokaryotic ribosomes.

8. The promoter is located downstream from the coding region of a gene.

9. RNA processing, common in eukaryotes, does not occur in prokaryotes.

10. General transcription factors are regulatory proteins that bind to eukaryotic RNA polymerases.

11. Ribozymes are primitive forms of RNA molecules that no longer exist in cells.

Fill in, etc

1. In a ribosome, the formation of the peptide bonds of the new peptide chain occurs in the __________________ subunit, whereas matching the codons of the mRNA are exposed on the surface of the _______________ subunit.   During the peptide elongation stage of translation, each in-coming aminoacyl-tRNA binds to the ___-site of the ribosome, where as the growing peptide chain is held on the tRNA in the ___-site. 

2. The end of translation is signaled by a ________ codon, which binds a protein called the _____________________.

3. In bacteria, the protein called the __________________ associated with the RNA polymerase is principally responsible for binding to the promoter.

4. Place the following events in their correct sequence:

      ___ Translation

      ___ Transcription

      ___ Polyadenylation

      ___ Capping

      ___ RNA processing

      ___ Nuclear export

5. Identify and explain 3 lines of evidence that support the RNA World theory.

6. RNA molecules possess both genotype and phenotype:

     A. The genotype of an RNA molecule is held in its ________________________.

     B. What are two examples of phenotype properties of an RNA molecule?

7.   Show and briefly explain how complementary base pairing can lead to replication of a strand of RNA with the following sequence:  AUCGCGUUAACCGUA

8. ‘Wobble base pairing’ will occur for which one of the following pairs codons? 

            A. AUG and UGG                 C. GGA and GGC

            B. AAA and UUU                 D. UAG and UGA

9. The codon for methionine is _____, the anticodon is _____, and the DNA code is ______.

10. Based upon the results of DNA sequencing for the Human Genome Project, the number of promoters suggests that there are around 25,000 genes in the human genome.  However, the number of different types of proteins may actually be much higher than this.  Why?

11. Introns are ‘junk’ DNA that create a burden on the species.  Give at least two reasons why this statement is incorrect?

12. A research lab purified the messenger RNA for a mouse protein called ‘GFI’ and reverse transcribed it into cDNA.  They then used the cDNA as a probe to locate the gene on the mouse chromosome, which they isolated and cloned.  To their surprise the coding region of the GFI gene was 5500 bases longer than that of the cDNA.  In an attempt to mass-produce the GFI protein, they transfected E. coli with double-stranded DNA derived from the cDNA, hoping that it could be produced in the bacteria, but the gene was not transcribed.

            A. How would you explain the difference in size between the cDNA and genomic forms of the               GFI gene?

            B. What would you do differently to achieve transcription of the GFI gene in bacteria?

13. The following is a segment of DNA containing the beginning of a gene

     3¢- GGCATACTTCAGTCAAGAGACATAG -5¢

     5¢- CCGTATGAAGTCAGTTCTCTGTATC -3¢

A. If an RNA polymerase were to transcribe the gene from left to right, is the top or the bottom strand serving as the template?

B. What will be the sequence of the mRNA produced (be sure to label the 5¢ and 3¢ ends of your RNA molecule)?

C. What is the amino acid sequence of the peptide that would be translated from the mRNA.  Label the N- and the C-terminus amino acids.

D. Which one of the following mutations would have the greatest effect on the structure of the protein? Explain.

            a. deletion of the underlined ‘GC’ pair

            b. substitution of TA pair for the underlined GC pair