Question Raiser...

1. Do we (humans) have Restriction Endonuclease?

In September 1986, Pubmed journal showed the evidence that there is Restriction Endonuclease present in humans. The presence of HsaI was identified. It was isolated from human embryo using tissue and cell extracts. The authors are Lao W.D. and Chen S.Y. It was found to be a TypeII and similar to EcoRI, although functionally differed. But till now nothing more is known about these HsaI enzyme.

2.Do Apoptosis occur in Bacteria?

As a function of Programmed cell death the bacteria die giving rise to newer cells either by spore formation or fruiting bodies. The cell death of bacteria is a fate of it written at genome level. Hence it is necessary for developmental stages, newer cell growth and increase in population.It also doesn't hamper other cells surrounding it, which proves another criteria.We can call it Apoptosis. 

Question Raiser

It has been all day long I was thinking of being myself as a CELL. Do you know we can call ourselves as a cell, well may be surely Diploid. Once in our lifetime with lowest cell density and volume although ratio may vary compared to now, we were formed. Thanks to those Cells who fused with an energy that can change the world and the Fusion product is finally You.
Why not we determine ourselves as those cells and having the Potential Energy within us to derive more meaningful way of life though neighboring cells exist to compete with us.
Okay. Let's Raise a question. Obvious fro the fact that we know something and is not clear will be questioned always.

1.Why don't we(Humans) have Restriction-Modification System?
Being a single celled bacteria are invaded by virus by the genetic material directly and needs an immediate restriction system and even to protect itself from the foreign genetic composition.
Whereas in humans, we have a higher organisation and the virus invasion occurs as whole virus entering our body. Hence there are other cell types(like macrophages) and specifically cell surface markers even to detect them. And hence we developed the so called Higher Version of RM system as Immune System.

And also we are prone to invasion by pathogens like bacteria, protozoans, worms and hence we need a flexible system to carry out restrictions for all these organisms.
May be true for instance.
It raises another Question :

2.Do the bacteria are invaded ONLY by viruses?
Certainly No. As there is a sole evidence of the antibiotic Penicillin from Penicillium rubens fungi causing the death of Staphylococci and Streptococci bacteria. The fungi was used by A. Fleming.
Hence may be there are other invading organisms although through chemical entities those can kill the bacterial cells. Why it is important to know is the chemical nature of peptidoglycan layer keeps it a secret.

A bio-Hypothesis

MY   PRESUMED   HYPOTHESIS

   “The only truth is death.”           

        Yet it’s true. The BIRTH is the interesting fact in all the time science has revealed and spiritually we are the GOD’s creation. And more interesting one is the DEATH. Basically we die just our time ends and our soul is being taken by the creator as the spiritual human believes. Science gives it a solution although particular proof does not exist. Scientifically the presence of soul has been proved by the scientists. A fact I am going to disclose before you might be absurd to hear but is a fact. A body just before some hours of his death was accidentally weighed for some medical tests. And he was sealed in a glass chamber for respective treatment and fully equipped. But he could not pass the treatment and died. The weight found to be exactly some 0.221g less than the original weight recorded before. Also there was a crack on the glass chamber. However may be it was electric, scientific or situation but for that moment it is presumed that the soul has been taken out of the body. It can also be explained as the metabolism and activities stopped and he died so the weight is lost. Then again a question arises why the glass was found broken in which the body was sealed?

“The sky is the daily bread of life.”

Why we take food and nutrition? The answer lies within the cells. The cells contain proteins, enzymes, fluids, genetic materials for our growth and development. But all are not available in the cells as we think. So to provide the cells their required enzymes, factors and nutritional substrates we are bound to eat. If we don’t eat or drink the body may exist on the things it has itself in the cells and will end our metabolism at finishing point. Then another question comes to mind even we take sufficient food and nutrition how we get old and why do we die?

      Ok leave it as a question unanswered. Now a very interesting truth I am disclosing about the BIRTH and DEATH. At the time of our formation by our parental gametes all is decided in our genes before we take birth and could see the sunlight. The genes as we know encode for certain functions in our body as protein synthesis. A basic concept lies in the chromosome rather a full matured chromosome. The telomeric sequence not the whole of two ends but only the one end of the chromosome contains the desired functional genes determining our age (although junk DNA is also replicated along with functional genes). The each replication of DNA , then its translation and the protein synthesis shortens some portion of the genes encoding our age. At the time of our birth we have been supplied with a variable number of functional genes for our extent of activities with respect to time different in different individual. As we grow our genes required for determination shortens but is negligible as compared to the replication process and we are called young at that certain period. But due to continuous removal of telomeric age determining genes we lose our efficiency to synthesize the required metabolic pathways for our body. And after certain years of passage almost all of our synthesizing genes for age determination ends and we have close our genomic activities which leads to the inability of the parts our body one by one and lastly stops at the eyelid. We have fixed time on this earth naturally. And all we have to use the time fully we have got in our genes. As a biotechnology learner and a human being I must tell the world not to make the stress out of any reason. The stress, tension, anger, sadness etc. will not be productive for our genes for the synthesis of desired protein, rather are the mutational factors to bring out our sudden collapse and death. We are not afraid of DEATH but certainly afraid of its way. So let it be in its way. The fact I have told you is a recently discovered truth about our genes specifically chromosomes. The longer the telomeric region longer will be the age of that individual. Yet another chapter is to be unfolded by the biotechnological research in space-biotechnology for the research of living matters like DNA in space.

“Something what we tell is already being told.

But today there is none to listen to them.”

 

 Another unanswered question remains as itself is that does the DNA exists even after we die and if yes where does it goes? Obviously the answer is yes the DNA exists in certain amounts after we die and also after the body is being burnt into ashes. My presume states a greater look into these facts biotechnologically will make us sure about them. Think about the fact strongly that we are diploid cells. And say to yourself “I am a diploid cell.” we have grown in the cytoplasm of environment and protoplasm of air. Yet we still fight for our existence. It’s very strange. Science and spiritual necessities can make us to discover new spectra of facts.

And I will tune as follows:

“A little pain, a little pleasure

A little heaping up of treasure

Then no more gazing upon the sun

All things must end that have begun.”

A fervour flamboyant detour waits for us far out at the beds of red Georgia hills and blade of grasses labeled with fluorephores  of our agile heresy.

Biotechnology Question Set 1

1.A continuous reactor is converting maltose to lactate, acetate and ethanol. The medium contains 40 g.l^-1 of maltose and the medium flow rate is 5 liters per hour and the effluent contains 20 g.l^-1 of lactate. What is the productivity of lactate production from this reactor?

   

1. 10 Liters Per Hour

   

2. 20 G Lactate/L

   

3. 100 G Lactate/H

   

4. 4 G Lactate/H

 

2.Transplastomics…..

   

1. Offers Little Opportunity For Practical Use

   

2. Produces Genes That Are Released In Pollen

   

3. Provides Exceptionally Low Yields Of Protein Products

   

4. Targets Genes In The Chloroplast

3.K_M values of enzyme X for substrate A and B are 0.1mM and 0.01mM respectively. This suggest that

P) Enzyme X has more affinity towards A

Q) Enzyme X has low affinity towards A

R) Enzyme X has more affinity towards B

S) Enzyme X has low affinity towards B

     1. Q, R

   

2. Q, S

   

3. R, S

   

4. P, Q

4.The specific growth rate (µ) of a microorganism in stationary phase is

   

1. 0 (Zero)

   

2. µ max

   

3. less than zero

   

4. greater than zero

5.Co-factor for Glutathione peroxidase is

   

1. Mo

   

2. Se

   

3. Mg

   

4. Fe

6.Match each parameter in group 1 with the appropriate measuring device in group 2

Group 1                     Group 2

P. Pressure                  1. Photometer

Q. Impeller speed       2. Rotameter

R. Turbidity                3. Diaphragm gauge

S. Flow rate                4. Tachometer

   

1. P-3, Q-4, R-1, S-2

   

2. P-1, Q-3, R-2, S-4

   

3. P-4, Q-1, R-2, S-3

   

4. P-1, Q-2, R-3, S-4

7.A fed-batch reactor initially contained 2 litre of medium and 1 g.l^-1 of substrate. It was fed at 1 litre per hour with a medium containing 1 g.l^-1 of substrate. After 10 hours, the concentration of substrate in the reactor was 0.5 g.l^-1. The mass of substrate that was used by the culture in the reactor was

   

1. 1 G

   

2. 3 G

   

3. 6 G

   

4. 12 G

8.A knock-out mouse is made using which of the following methods/technologies?

   

1. Monoclonal Antibody

   

2. Antisense Oligonucleotide

   

3. Transgenic

   

4. Animal Cloning

 

9.The phenomenon in which substrates are used in a sequential manner is known as

   

1. Dialysis

   

2. Multiplicity

   

3. Diauxie

   

4. Dialism

10.How many kilograms of ethanol is produced from 1 kilogram of glucose in ethanol fermentation?

   

1. 2.00

   

2. 0.20

   

3. 0.51

   

4. 0.05

 

11.Molecular clock of evolution could be traced on basis of

   

1. Comparison Of Short Arm Of 16-S RNA

   

2. Substitution In Amino Acids Of Polypeptide Due To Mutation

   

3. DNA Fingerprinting

   

4. Fossil Study 

12.Alkaline phosphatase is used

   

1. To Remove A Phosphate At The 5`End Of DNA

   

2. To Remove A Phosphate At The 3`End Of DNA

   

3. To Add A Phosphate At The 5`End Of DNA

   

4. To Add A Phosphate At The 3`End Of DNA

 

13.The following antibiotics affect the bacterial protein synthesis with their site of action. Which of the following combinations is correct?

Antibiotic                                Site of action
P. Streptomycin                     1. aminoacyl tRNA association with ribosome
Q. Tetracycline                      2. Transpeptidation
R. erythromycin                    3. Translocation
S. Chloramphenicol              4. Initiation of protein synthesis

   

1. P-2; Q-3; R-4; S-1

   

2. P-4; Q-1; R-3; S-2

   

3. P-1; Q-4; R-3; S-2

   

4. P-4; Q-1; R-2; S-3

14.A fermentation system has a k_La of 3 s^-1 and a C_o^* of 5 ppm of O₂. If the bulk liquid is completely depleted of oxygen, then the oxygen transfer rate will equal to

   

1. 5 Mg/L/S

   

2. 10mg/L/S

   

3. 15 Mg/L/S

   

4. Zero

 

15.In a Lineweaver-Burk treatment of data, which of the following plots would give you a straight line of gradient Km/Vmax?

   

1. 1/V Against [S]

   

2. 1/V Against 1/[S]

   

3. V Against 1/[S]

   

4. V Against [S]

16.A chemostat has a liquid volume of 2 litres and is being fed at a rate of 4 litres per hour. The dilution rate for this reactor would be

   

1. 2 Per Hour

   

2. 4 Litres Per Hour

   

3. 2 Litres

   

4. 8 Litres Per Square Hour

17.An E. coli strain that requires the amino acid lysine for growth is termed a/an

   

1. Autotroph

   

2. Auxotroph

   

3. Lysotroph

   

4. Prototroph

18.Pseudomonas aeruginosa has a maximum specific growth rate of 0.8 h^-1 when grown on glucose as a growth limiting substrate. To ensure that the cells do not washout, the dilution rate must be set to

   

1. Equal To 0.8 /H

   

2. Greater Than 0.8 /H

   

3. Less Than 0.8 /H

   

4. Less Than Half The Inverse Of The Residence Time

19.A strain of Azotobacter is cultured in a 15 m³ stirred bioreactor for alginate production. Under operating conditions k_La is 0.17 s^-1. Oxygen solubility in the broth is 8×10^-3kg m^-3. The specific rate of oxygen uptake is 12.5mmol g^-1h^-1. The Maximum possible cell concentration is

   

1. 10 G /L

   

2. 12 G /L

   

3. 14 G /L

   

4. 8 G /L

20.Shine-Dalgarno sequences are associated with

   

1. Transcription

   

2. Translation

   

3. Replication

   

4. Recombination

21. Which of the following would not be expected to result in a dysfunctional protein?
      a.Mutation affecting the splice site of an intron
      b.Substitution of glycine for alanine at the carboxyl terminus
      c.Insertion of two bases in the code for the amino end
      d.Nonsense mutation affecting the middle of a potential protein product
      e.Deletion of a single base of a codon near the middle of a potential protein
 
22. Which of the following is a true statement about translation?
      a.The genetic code can be overlapping
      b.The first nucleotide in a codon has less specificity than the others
      c.Only one group of nucleotides codes for each single amino acid
      d.Every codon (three nucleotide bases) specifies an amino acid
      e.Specific nucleotide sequences signal termination of peptide chains
 
23. A patient suffers from adenosine deaminase (ADA) deficiency, an autosomal recessive immune deficiency in which bone marrow lymphoblasts cannot replicate to generate immunocompetent lymphocytes. The treatment option that would permanently cure the patient is
      a.Germ-line gene therapy to replace one ADA gene copy
      b.Germ-line gene therapy to replace both ADA gene copies
      c.Somatic cell gene therapy to replace one ADA gene copy in circulating lymphocytes
      d.Somatic cell gene therapy to replace both ADA gene copies in circulating lymphocytes
      e.Somatic cell gene therapy to replace one ADA gene copy in bone marrow lymphoblasts
 
24. The proopiomelanocortin (POMC) gene encodes several regulatory proteins that affect pituitary function. In different brain regions, proteins encoded by this gene have different carboxy-terminal peptides. Which of the following best explains the regulatory mechanism?
     a.POMC transcription is regulated by different factors in different brain regions
     b.POMC translation elongation is regulated by different factors in different brain regions
     c.POMC transcription has different enhancers in different brain regions
     d.POMC protein undergoes different protein processing in different brain regions
     e.POMC protein forms different allosteric complexes in different brain regions

25. A family in which several individuals have arthritis and detached retina is diagnosed with Stickler syndrome. The locus for Stickler syndrome has been mapped near that for type II collagen on chromosome 12, and mutations in the COL2A1 gene have been described in Stickler syndrome. The family became interested in molecular diagnosis to distinguish normal from mildly affected individuals. Which of the results below would be expected in an individual with a promoter mutation at one COL2A1 gene locus?
     a.Western blotting detects no type II collagen chains
     b.Southern blotting using intronic restriction sites yields normal restriction fragment sizes
     c.Reverse transcriptaseñpolymerase chain reaction (RT-PCR) detects one-half normal amounts of COL2A1 mRNA in affected individuals
     d.Fluorescent in situ hybridization (FISH) analysis using a COL2A1 probe detects signals on only one chromosome 12
    

e.DNA sequencing reveals a single nucleotide difference between homologous COL2A1 exons
Answer key:

1-b
2-e
3-e
4-d
5-c

Question On 3rd Sep.CMB 613

DNA to PROTEIN

From DNA to Protein

Multiple Choice

1.  During the process of translation:

         A. the peptide is ‘passed’ from the tRNA in the P-site to the tRNA in the A-site.

         B. incoming tRNAs must first bind to the E-site.

         C. initiation begins with the binding of the ribosomal SSU to the poly-A tail of the mRNA.

         D. the mRNA is translated by one ribosome at a time.

2. The presence of a poly-A tail on a RNA molecule indicates that:

         A. there are exons present that must be removed.

         B. this RNA molecule does not contain introns.

         C. the transcript should be immediately degraded.

         D. this is a rRNA molecule.

         E. None of the above answers is correct

3.  A ‘proteasome’ is a large structure in the cytoplasm that:

         A. translates mRNA into protein           C. supercoils DNA

         B. processes RNA                                  D. enzymatically degrades proteins

4. During the processing of introns, a single snRNP complex catalyzes both the cleavage of the RNA and the joining of the cut ends.  What would be the consequence if these two processes were catalyzed by separate enzymes not associated in a single complex?

         A. the rate of RNA processing would be much faster.

         B. the cell would be unable to identify the correct cleavage sites.

         C. the exons might not be joined in the correct sequence.

         D. exons instead of introns would be cleaved from the RNA molecule.

5. The nucleolus of the nucleus is the site where:

         A. RNA processing occurs

         B. rRNA is transcribed and ribosomal subunits are assembled

         C. tRNA are charged with amino acids

         D. mRNA is translated into protein

6. During "RNA processing"

         A. all of the exons are removed and discarded

         B. the RNA molecule is made from a DNA template.

         C. introns are cut from the RNA and the exons are spliced together.

         D. the RNA molecule is translated into a protein molecule.

7. How does the cell ‘mark’ the positions of introns in an immature RNA?

         A. There is a special snRNP for each type of intron.

         B. Codons called ‘cut’ and ‘paste’ (copyrighted by Microsoft) are present within the RNA.

         C.  It doesn’t need to, since the boundary between an intron and exon alternates frequently.

         D. Special sequences are located near the splicing sites which are recognized by ribozymes.

                                                                                                           

8. “Alternative splicing” refers to:

         A. the use of introns as exons, or vice versa, during RNA processing

         B. splicing out of damaged DNA by DNA repair enzymes.

         C. joining of RNA from two different genes to form a new mRNA.

         D. the use of alternative reading frames when translating an mRNA.

         E. a new dance for people with alternative life styles.

9.  During transcription of DNA to RNA:

         A. an RNA polymerase moves along the DNA in the 5’ to the 3’ direction .

         B. the 3’ end of the RNA molecule is produced first.

         C. an RNA polymerase must first bind to a promoter sequence.

         D. transcription is always initiated at a “start codon.”

10.  During the ‘elongation’ stage of translation, after the arrival of each new tRNA:

         A. the amino acid is ‘passed’ from the tRNA in the A-site to the tRNA in the P-site.

         B. newly arriving tRNAs must first bind to the E-site.

         C. the peptide is ‘passed’ from the tRNA in the P-site to the tRNA in the A-site.

         D. the new tRNA must first bind to the P-site of the ribozome.

11. During transcription of a particular gene, the RNA polymerase will transcribe:

         A. both strands, but only one of RNA molecule will be used.

         B. only one of the DNA strands, moving in a 3’ to 5’ direction along the template.

         C. both strands, but moving 3’ to 5’ for one and 5’ to 3’ along the other.

         D. only the exons of the gene while skipping over the introns.

12. Since the two strands of the DNA molecule are complementary, for any given gene:

         A. The RNA polymerase can bind to either strand.

         B. Only one strand actually carries the genetic code for a particular gene.

         C. Each gene possesses an exact replica that can be used should a mutation occur.

         D. A gene transcribed in the 5’ to 3’ direction on one strand can be transcribed  in the 3’ to 5’ direction on the other strand.

13. In the genetic code there are:

         A. more tRNAs than codons.                C. more nucleotides than codons.

         B. more codons than amino acids.         D. the same number of codons and amino acids

14. Initiation of translation begins when the:

         A. large and small subunits link together, then bind to the mRNA.

         B. ribosomal small subunit holding an initiator tRNA binds to the 5’ end of the mRNA.

         C. ribosome binds to the start codon and an initiator tRNA enters the ribosome.

         D. initiator tRNA binds to the start codon, followed by binding of the ribosome large subunit.

15. A “TATA box” is

A. the translation termination sequence.

B. an important base sequence in the promoters of bacteria.

C. the site where the RNA polymerase II binding complex is assembled.

D. an example of one of the translation stop codons.

16. According to the RNA-world theory:

            A. RNA molecules were the first organic molecules formed on earth.

            B. Life evolved on another planet called the “RNA World.”

            C. All RNA molecules in cells are “ribozymes.”

            D. Primitive RNA molecules evolved before protein and DNA

17. It seems probable that DNA contains thymine instead of uracil because:

            A. thymine is chemically much more stable than uracil.

            B. when uracil is chemically deaminated, thymine is produced.

            C. thymine was one of the first four nucleotides in primitive RNA molecules.

            D. if cytosine is deaminated, the altered base can be detected and removed.

True or False

1. Each of the 3 potential reading frames of an mRNA can produce a functional, but different, protein.

2. Transcription is terminated when the RNA polymerase encounters a poly-U sequence.

3. Translation ends when a ‘release factor’ protein binds to a stop codon.

4. Initiation of translation in prokaryotes involves binding of the sigma factor to a promoter.

5. Only rRNAs are polyadenylated.

6. Because genes can be coded on either strand of the DNA double helix, the coding regions of different genes can overlap.

7. Some antibiotics have selective effects upon prokaryotic ribosomes.

8. The promoter is located downstream from the coding region of a gene.

9. RNA processing, common in eukaryotes, does not occur in prokaryotes.

10. General transcription factors are regulatory proteins that bind to eukaryotic RNA polymerases.

11. Ribozymes are primitive forms of RNA molecules that no longer exist in cells.

Fill in, etc

1. In a ribosome, the formation of the peptide bonds of the new peptide chain occurs in the __________________ subunit, whereas matching the codons of the mRNA are exposed on the surface of the _______________ subunit.   During the peptide elongation stage of translation, each in-coming aminoacyl-tRNA binds to the ___-site of the ribosome, where as the growing peptide chain is held on the tRNA in the ___-site. 

2. The end of translation is signaled by a ________ codon, which binds a protein called the _____________________.

3. In bacteria, the protein called the __________________ associated with the RNA polymerase is principally responsible for binding to the promoter.

4. Place the following events in their correct sequence:

      ___ Translation

      ___ Transcription

      ___ Polyadenylation

      ___ Capping

      ___ RNA processing

      ___ Nuclear export

5. Identify and explain 3 lines of evidence that support the RNA World theory.

6. RNA molecules possess both genotype and phenotype:

     A. The genotype of an RNA molecule is held in its ________________________.

     B. What are two examples of phenotype properties of an RNA molecule?

7.   Show and briefly explain how complementary base pairing can lead to replication of a strand of RNA with the following sequence:  AUCGCGUUAACCGUA

8. ‘Wobble base pairing’ will occur for which one of the following pairs codons? 

            A. AUG and UGG                 C. GGA and GGC

            B. AAA and UUU                 D. UAG and UGA

9. The codon for methionine is _____, the anticodon is _____, and the DNA code is ______.

10. Based upon the results of DNA sequencing for the Human Genome Project, the number of promoters suggests that there are around 25,000 genes in the human genome.  However, the number of different types of proteins may actually be much higher than this.  Why?

11. Introns are ‘junk’ DNA that create a burden on the species.  Give at least two reasons why this statement is incorrect?

12. A research lab purified the messenger RNA for a mouse protein called ‘GFI’ and reverse transcribed it into cDNA.  They then used the cDNA as a probe to locate the gene on the mouse chromosome, which they isolated and cloned.  To their surprise the coding region of the GFI gene was 5500 bases longer than that of the cDNA.  In an attempt to mass-produce the GFI protein, they transfected E. coli with double-stranded DNA derived from the cDNA, hoping that it could be produced in the bacteria, but the gene was not transcribed.

            A. How would you explain the difference in size between the cDNA and genomic forms of the               GFI gene?

            B. What would you do differently to achieve transcription of the GFI gene in bacteria?

13. The following is a segment of DNA containing the beginning of a gene

     3¢- GGCATACTTCAGTCAAGAGACATAG -5¢

     5¢- CCGTATGAAGTCAGTTCTCTGTATC -3¢

A. If an RNA polymerase were to transcribe the gene from left to right, is the top or the bottom strand serving as the template?

B. What will be the sequence of the mRNA produced (be sure to label the 5¢ and 3¢ ends of your RNA molecule)?

C. What is the amino acid sequence of the peptide that would be translated from the mRNA.  Label the N- and the C-terminus amino acids.

D. Which one of the following mutations would have the greatest effect on the structure of the protein? Explain.

            a. deletion of the underlined ‘GC’ pair

            b. substitution of TA pair for the underlined GC pair